micro bio spintm p 30 gel column (Bio-Rad)
Bio-Rad is a verified supplier 
Bio-Rad manufactures this product 
96
Structured Review
Bio-Rad
micro bio spintm p 30 gel column
Micro Bio Spintm P 30 Gel Column, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 364 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/micro+bio+spintm+p+30+gel+columns/Micro+Bio-Spin+P-30+Gel+Columns/pm41547900-317-13-18
Average 96 stars, based on 364 article reviews
Micro Bio Spintm P 30 Gel Column, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 364 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/micro+bio+spintm+p+30+gel+columns/Micro+Bio-Spin+P-30+Gel+Columns/pm41547900-317-13-18
Average 96 stars, based on 364 article reviews
micro bio spintm p 30 gel column - by Bioz Stars,
2026-10
96/100 stars
Images
Related Articles
other:Article Title: CREPT is required for the metastasis of triple-negative breast cancer through a co-operational-chromatin loop-based gene regulation Article Snippet: Article Title: A CDK11-dependent RNA polymerase II pause-checkpoint precedes CDK9-mediated transition to transcriptional elongation Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER μMACS Streptavidin Kit Miltenyi Biotec Cat#130-074-101 NucleoSpin Gel and PCR Clean-up Mini kit Macherey-Nagel Cat#740609 NucleoSpin Plasmid Mini kit Macherey-Nagel Cat#740588 Deposited data RNA-seq data This paper GSE280102 ChIP-seq data This paper GSE280208 PRO- and TT-seq data This paper GSE280103 Mass spectrometry data This paper PXD066230 Experimental models: Cell lines Human: THP-1 American Type Cell Culture® (ATCC®) Cat#TIB-202; RRID: CVCL_0006 Human: MV4;11 ATCC® Cat#CRL-9591; RRID: CVCL_0064 Human: BJ-T ATCC® Cat#CRL-2522; RRID: CVCL_6573 Human: MM1.S ATCC® Cat#CRL-2974; RRID: CVCL_8792 Human: OCI-AML3 German Collection of Microorganisms and Cell Cultures GmbH (DSMZ) Cat#ACC 582; RRID: CVCL_1844 Human: HEK293T ATCC® Cat#CRL-11268; RRID: CVCL_0063 Human: HCT116 ATCC® Cat#CCL-247; RRID: CVCL_0291 Drosophila melanogaster: S2 ATCC® Cat#CRL-1963; RRID: CVCL_Z232 Murine: Mll-Af9 Nras G12D mCherry Baker et al., 30 ; Peter MacCallum Cancer Centre N/A Murine: Eμ-Myc 4242/3.2 Shortt et al., 103 ; Peter MacCallum Cancer Centre N/A Murine: Eμ-Myc 6066/2.1 Shortt et al., 103 ;Peter MacCallum Cancer Centre N/A Murine: Eμ-Myc 299/2.1 Shortt et al., 103 ; Peter MacCallum Cancer Centre N/A Spodoptera frugiperda: Sf21 Professor Mark Hogarth, Burnet Institute, Melbourne VIC 3000, Australia RRID: CVCL_0518 Experimental models: Organisms/strains Mice: C57Bl/6 The Walter and Eliza Hall Institute, Melbourne VIC 3000, Australia N/A Oligonucleotides Scrambled (SCR) sgRNA for Human cells GCCTAGTCTCGGTAAGAGTG Doench et al. 104 Non-Targeting Control sgRNA targeting Human CDK11A/B (for CDK11A/B knockout)sense: TCCCAC ATCACCGAACGATGAGAGantisense: AAACCTCTCATCGTTCGGTGATGT Doench et al. 104 ID_2782 sgRNA targeting Human CDK11B (for CDK11B G579S homology-directed-repair) GGGTGACTTCGGGCTGGCGC This paper N/A DNA donor template for Human CDK11B G579S mutationAGCCACGCCGGCATCCTCAAG GTGAGCCCCCCTCCGAGTGGCCCATC CCAGGGAGACCTGCCGGGGCCCACTC ACAGCCGCCCATCTGTCGTTGCAGGTG AGTGATTTTGGACTGGCGCGGGAGTAC GGATCCCCTCTGAAGGCCTACACCCCG GTCGTGGTGACCCTGTGGTACCGCGCC CCAGAGCTGCTGCTTGGTG This paper N/A (Continued on next page) ll OPEN ACCESSArticle Molecular Cell 85, 1–20.e1–e13, September 4, 2025 e3 Article Title: A CDK11-dependent RNA polymerase II pause-checkpoint precedes CDK9-mediated transition to transcriptional elongation Article Snippet: To enrich biotin-CTP-incorporating RNA, hydrolysed RNA was incubated with 30μL streptavidin DynaBeads (Invitrogen 11206D; prewashed with 1) 100mM NaOH, 50mM NaCl and 2) 100mM NaCl and resuspended in binding buffer (100mM Tris-HCl pH 7.4, 300mM NaCl, 0.1% (v/v) TritonX-100) at room temperature for 20 minutes (tumbling at 8rpm). Generated:Article Title: Altered socio-affective communication and amygdala development in mice with protocadherin10-deficient interneurons. Article Snippet: In vitro transcription was performed by adding linearized plasmid, Sp6 polymerase (Roche), DIG labelling mix (Roche) and RNase inhibitor (Roche) in 1× reaction buffer (Roche) and incubated overnight at 37°C. .. Generated probes were purified using Purification:Article Title: Altered socio-affective communication and amygdala development in mice with protocadherin10-deficient interneurons. Article Snippet: In vitro transcription was performed by adding linearized plasmid, Sp6 polymerase (Roche), DIG labelling mix (Roche) and RNase inhibitor (Roche) in 1× reaction buffer (Roche) and incubated overnight at 37°C. .. Generated probes were purified using Article Title: Regulation of the Yolk Microtubule and Actin Cytoskeleton by Dachsous Cadherins during Zebrafish Epiboly Article Snippet: The process involved in assembling RVD-containing repeats and subcloning TALE repeats into modified TALE nuclease expression vectors was performed using the REAL Assembly TALEN Kit (Addgene TALEN kit 1000000017) (Sander et al., 2011). .. TALEN RNAs were synthesized using SP6 mMessage mMachine Kit (Ambion) and purified by Synthesized:Article Title: Regulation of the Yolk Microtubule and Actin Cytoskeleton by Dachsous Cadherins during Zebrafish Epiboly Article Snippet: The process involved in assembling RVD-containing repeats and subcloning TALE repeats into modified TALE nuclease expression vectors was performed using the REAL Assembly TALEN Kit (Addgene TALEN kit 1000000017) (Sander et al., 2011). .. TALEN RNAs were synthesized using SP6 mMessage mMachine Kit (Ambion) and purified by |